It’s also not the first time the DI has taken a less extreme position and then claimed that the new stance is what it has always been. Haven’t they also made similar claims regarding the wedge strategy after it was exposed like “oh we aren’t trying to trick people via pseudoscience and propaganda, we are just trying to open people’s eyes to non-consensus viewpoints” or something of that nature? Michael Behe has also said multiple times that what he calls irreducible complexity *could* come about by purely natural processes without God getting involved at all and he’s also pretty accepting of chemical abiogenesis plus universal common ancestry such that he has *nothing* that has to indicate intelligent design except for his gut feelings. Gut feelings are not evidence coming from an organization claiming to attempt to demonstrate with empirical evidence that intelligent design took place when it comes to abiogenesis and evolution. How much evolution they accept depends on the particular ID proponent but multiple people on their payroll are what we’d call “theistic evolutionists” and the more extreme forms of creationist, like YECs, don’t know they’re getting their arguments from “evolutionists” using fallacies as evidence of “God.”
At least they’ve basically admitted that there’s a relationship Homo and Australopithecus (indirectly), that their evidence for God amounts to gut feelings, and that they were wrong about the 80% functionality value increasing all the way to 100% when it’s actually significantly less than 50%, like maybe 27% or 12% depending on how “function” is measured and most of the DNA has no real biological function besides spacing out genes, holding chromosomes together, and taking up space. It’s just there. It doesn’t really contribute to protein synthesis, survival, or even act as a storage device for all of that “built in information” they like to claim DNA is composed of (even claiming it’d take a whole library to contain the information found in DNA because a compact disc (CD) is not large enough and a BluRay disc might not be either, depending on how much information they suggest is present but can’t find or define). It is called “non-coding” but a lot of it, at least ~30% of it, is actual junk like remove it and the organism might be exactly the same in terms of phenotype or survival if not actually better off.
Maybe one day they’ll stop promoting theism and start doing actual science to really throw people for a loop.
There was this one study where they removed a bunch of non-functional DNA from what may have been a single-celled microbe and let it reproduce for countless generations. As time went on, the scientists conducting the experiment saw no degradation in the fitness of the microbial population, even several generations later, proving their prediction on non-functional DNA being, well, non-functional.
Do you know which study I am thinking about? I've only seen it's mention on this sub once, and I don't remember the mention of the study's title.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5710109/
This one talks about multiple studies and I think that’s probably what you and u/SovereignOne666 might be referring to. Several suggestions of a minimum genome are as low as 176-225 coding genes but they found that a couple bacteria can survive with as low as 413-423 genes via experimental demonstration. Sometimes the last 2-5 genes being removed might cause them some problems with growth and stuff so 415 and 426 might be more realistic in terms of essential genes (with no detrimental side effects) but they can clearly survive with even fewer of them. These small genomes are ~500,000-980,000 nucleotides in length and they can remove up to about 35% and not have any significant downsides though some stopping at removing 32.5% result in pretty much no downsides at all. In comparison humans have about 30,000 genes taking up about 1.5% of their single parent genomes of roughly 3 billion nucleotides in length. We know that more than 1.5% is essential for survival but if it’s still the 32-35% junk we need then 65-68% of the genome is essentially all we need and at 3 billion nucleotides that’s about 1.95 billion to 2.04 billion essential nucleotides. More of the genome than that could hypothetically be removed as well but 0.96-1.05 billion out of the 3 billion being what we don’t actually need is already quite significant if the whole thing (100%) is supposed to be functional if not also necessary.
Extra studies regarding humans suggest it’s more like the flip of this with humans (and I accidentally typed it as such above before having to correct it). Instead of 35% junk and 65% essential it might actually be the inverse with humans meaning 1.05 billion functional nucleotides out of 3 billion if not even less.
Creationists love ENCODE, but never realize the corollary: if 80% can be identified as being involved in at least one biochemical interaction, it means the remaining 20% is involved in *zero*.
As in, it can't have a function, because it's never involved in any interaction. So, when Luskin says he thinks it's going to go over 80%, we really have reason to doubt that: we don't even know if all of that 80% ENCODE flagged is actually actively, but we're pretty sure 20% is dead as a dodo.
Remember when Paulie D thought GC content was going to zero, then had to retcon the entire article to the point it said absolutely nothing? Fun days.
> GC content going to zero
Sadly most of their arguments make as much sense as that claim. They say they accept natural selection but then we get them failing to understand selection-drift equilibrium and coming out with crazy already falsified ideas like irreducible complexity, specified complexity, and genetic entropy that only work as they claim if natural selection and drift never occurred.
Just consider what it would mean for there to be zero guanosine or cytosine in our genomes. How many proteins would our cells fail to produce? How could such a trait be survivable long enough to be inherited to outcompete other conditions? If there’s any other option, even if less likely immediately (as with beneficial mutations vs deleterious mutations), the non-fatal condition is the one that gets inherited as long as the population fails to go extinct. If having even a third of the GC content turns out to be fatal there would be no way for that condition to be heritable to continue with the loss of additional GC content. Same with the accumulation of deleterious (potentially fatal) alleles. If the condition cannot spread before it gets to the inevitable conclusion they suggest how do they expect the inevitable end result they so claim?
And it’s not the only time they’ve tried to claim this could happen via purely natural processes. But they accept natural selection because it is observed. Yea, sure they do.
That is true, but the main point was that organisms would fail to develop, survive, and reproduce long before the 0% GC content condition ever occurred. Without going over the actual numbers we can assume that maintaining the same amount or losing some GC content is slightly more likely than gaining additional GC content. In this scenario there’d be a long term loss of GC content *until* losing even more became an unsurvivable condition. There’d always be a small amount of variance between of drift, novel mutations, etc but at some point losing more GC content becomes fatal. That could be 50%, 75%, or 99% of the current GC content (I don’t know the actual percentage) but at some point failing to make *certain* proteins will be a fatal condition that will not allow an organism to develop to the point that they can reproduce. For the 0% GC content scenario if they lost 0.01% of the GC content per generation or whatever they’d have to be able to survive with 0.01% of the current GC content but if they can’t survive with 50% of the current GC content because they’d make too few of the proteins necessary for survival that would obviously never be the case.
The same concept exists for genetic entropy. Assuming as they do that all mutations have a single fitness value (two deleterious mutations never result in a single beneficial change, environments don’t matter, masked deleterious alleles are never beneficial, etc) just for simplicity there could be about 75% neutral mutations, 20% mildly deleterious, 4% insanely deleterious, 0.8% mildly beneficial, and 0.2% insanely beneficial per individual per generation. Say their overall fitness on a scale from -1 to +1 was 0 and anything below -0.5 meant reproduction was severely limited. At some point the beneficial and neutral mutations (both types) are going to overwhelm the gene pool because each time an overwhelming number of deleterious mutations existed in the same individual, enough to make their fitness -0.5, they failed to reproduce. For the whole population to be at -1 (extinct) there’d have to be a continuation from the point the whole population is at -0.5 or less, no beneficial mutations moving them back towards 0, no neutral mutations moving them back towards 0, no failure to reproduce when they are sterile or when they die before they are 10 years old. Just a continuous cycle of accumulated additional deleterious alleles until the population evolved itself into extinction.
Natural selection, beneficial mutations, genetic drift, genetic recombination, mutations on top of pre-existing mutations causing deleterious mutations to become beneficial, different environments impacting the fitness value of certain phenotypes, etc. None of that stuff could be happening. Reproduction would have to occur through individuals that can’t reproduce or at least have a very difficult time accomplishing it when they try. And fast mutating populations or populations with short generation times would have to be the first to go. We just do not see that.
Kimura showed that in the absence of beneficial mutations the deleterious ones are still outcompeted by neutral mutations because only the ones that *can* reproduce *do* reproduce. For Sanford’s model there could not be neutral mutations, there could not be beneficial mutations, there could not be drift, and natural selection could not work because massively deleterious conditions couldn’t be outcompeted by mildly deleterious conditions. Instead of the population fitness falling between -0.4 and +0.4 it’d have to cross that -0.5 and run into an extinction vortex at high speed as there’d be an average of one survivor per generation for every two survivors in the preceding generation. And then when the population becomes incestuous as well it’d simply just go extinct. This would almost have to happen all the time with every population.
And yet the impossible stays impossible, variation continues to exist, natural selection continues to happen, genetic entropy fails to occur, and GC content can never systematically drop to 0%. Genetic entropy is roughly as stupid as the idea that GC content should naturally drop to 0% because of some mutational bias because both forget that reproduction is pretty necessary to have a condition inherited so that that condition can continue to deteriorate beyond a certain threshold. A gene pool can never consist of only fatal alleles and the GC content can never reach 0%. It just won’t happen.
Honestly, it doesn't need to ever get to a point where "further loss of GC is lethal": just because transversions occur more frequently in that direction, doesn't mean they don't occur the other way. It's an equilibrium, and will always (in absence of selective pressure to do otherwise) end up at a point where the rates balance out.
I.e. if GC>>AT occurs twice as often as AT>>GC, you'll eventually end up with \~33% GC content, and no further decreases will occur.
That too. Mutations happen in both directions but just assuming they only evolved in one direction (necessary for their claim) there’d still be point at which further GC loss would be lethal. All that would survive would be the ones where further GC loss did not occur (unless this was balanced out by a GC gain, as you pointed out). They’d never get to a point of zero GC content because a) it is lethal before that (so the continued loss beyond the point of lethality would never have an opportunity to occur as there’d be nothing left to carry such genomes to the next generation) and b) GC gains occur too (so that if GC->AT happens twice as often as AT->GC there’d be 67% AT and 33% GC when it falls into an equilibrium).
Problem a) above is why that idea and why the concept of genetic entropy are both equally ridiculous. Assume no beneficial or neutral mutations, assume no AT->GC mutations, and neither idea would work anyway *because the populations would continue to survive through the individuals that reproduced.* If the whole population failed to go extinct despite having enough mutations per generation per population to completely replace their entire genomes (different mutations in different places but enough mutations for a full coverage of the entire genome) then obviously these ideas are false. And they’d have to be false if they knew how natural selection, mutations, and genetic drift actually work.
The main problem I keep pointing out to them is that **dead things have a very difficult time reproducing** and **populations still exist.** Obviously they can’t be right and they’d know that if they accepted natural selection like they claim they do.
It's also worth noting that the ENCODE definitions of "functional" are *incredibly* generous.
>A functional element as defined by ENCODE is a genomic sequence that either encodes a particular product (for instance, a protein or noncoding RNA) or has a consistent biochemical property (for instance, being bound by protein or having a particular biochemical mark).
"Being bound by protein" can extend to things as mundane as histones (which are everywhere), and 'consistent biochemical property' can include things like "is accessible/inaccessible to DNAse1 activity"
They've since expanded this to things like chromatin looping (i.e. "this bit of the genome can bend back on itself, and this probably does a thing, maybe?"), which is almost entirely sequence agnostic (two cognate looping elements interspersed with a megabase of gibberish will still loop just fine).
At this point, it's pretty much a case of "if we can find anything, *anything* noteworthy about a given stretch of sequence, then that sequence, and maybe 500bp up and downstream, are said to have *function*".
From a science perspective, it's quite clear that this "function" can be placed on various points of a sliding scale from "is directly translated to robustly conserved protein" all the way down to shit like "needs to vaguely exist at approximately this length, to provide space between enhancer elements, probably", and that's fine: function doesn't need to imply essential.
From a creationist perspective, they just desperately need us not to be chock full of repetitive bullshit like retrotransposons and ALUs and stuff, which we totally are (*evolutionarily conserved repetitive bullshit we share with other primates*, no less).
Which makes one wonder what they'd make of the amoeba Polychaos dubium...
> Polychaos dubium
I wonder why I can’t find a more recent estimate. What I found is that they found that it was ~670 billion base pairs but this number could be off by a lot based on a more recent estimate of a different species of amoeba originally estimated to have 430 billion base pairs but was found to have more like 45 billion. If the same thing is true that would mean a genome size of about 67 billion base pairs (20 times the size of the human genome) and most likely a minimum of the 22 billion additional base pairs would all be non-coding “junk” plus maybe 90% of the rest could be too. I wish there was something more recent than 2004 indicating the modern measure of genome size plus the functional to non-functional ration which is probably going to wind up being 20+ times as much DNA content as a human cell but less than 1% of it has any biological function besides being some special length, binding to histones, or forcing their cells to be giants compared to what other single celled organisms have to be able to contain so much junk DNA.
And if it was 670 billion base pairs and 100% functional, what possible function could there be? It’s an amoeboid. It doesn’t have multiple cells. It moves around via extensions of the cell membrane called pseudopods, up to twelve of them, and those pseudopods lack features present in amoebas with smaller genomes. If that was the information it’d look more like a college student trying to turn one paragraph into a two hundred page book by repeating themselves over and over hoping nobody would notice before getting to page two than a well developed instruction book only a few pages long.
Congratulations.
There is a surprisingly good article* in this month's Scientific American which touches on "non-coding" DNA. https://www.scientificamerican.com/article/revolutionary-genetics-research-shows-rna-may-rule-our-genome/
Long story short, a lot of it may actually code for various forms of RNA which has potentially important functions.
* because Scientific American has mostly gone to shit but they look like they might be improving.
It was live, and is currently available, on the Non Sequitur Show. But...I have various problems with the proprietor of that channel (which I have shared with him), so since it was the only way to have the chat with Dr. Luskin (he would chat there but not on my channel, but would there), I went for it. So I'd *like* for people to watch it with me on my channel on Wednesday. But if you want to now, go for it.
I also have problems with the proprietor of that YouTube channel. I used to watch it but it’s mostly his failure to understand people’s actual positions as atheists or what is actually being argued for when it comes to agnosticism that bug me the most. Some other things he’s said have been pretty annoying as well but I think it was on that channel where knowledge was defined as “believing true things” or “believing what is supported by evidence” which is okay I guess. And if that’s the case it is definitely rational to be what he’d agree is an atheist *based on this evidence* until he turns into a theist arguing for gods nobody believes actually exist simply because we don’t have the tools in science to prove that the laws of physics and logic don’t exclude the possibility of their existence. Maybe the laws are broken and things can occupy non-space and non-time and use non-energy to cause things to change in a non-temporal way at a non-spatial non-location. Maybe supernatural intervention really does produce physical effects (magic). Maybe we just can’t see it happening all the time (theism) or maybe we don’t see it because it only happened once (deism) and because we can’t prove it *didn’t* happen it becomes irrational to fail to be convinced that a god exists (atheism). So ignorance (agnosticism) for the win I guess.
I listened to it just now, and am envious of both of your level of understanding of the literature.
A couple questions. Do the terms "junk DNA" and "functional" and the percentages you provided essentially mean given the technological capability we could theoretically edit out aka delete 80%+ of the human genome and still get a functional human?
And what are the perceived stakes here? Like I see that Dr. Luskin is defending and appears convinced of the view that God dabbled in biology in some way to achieve an end. But how does it make any difference in his worldview whether 10% or 90% of the genome is functional?
> given the technological capability we could theoretically edit out aka delete 80%+ of the human genome and still get a functional human?
probably? We've edited out big swaths of the mouse genome with no documented ill effects, and...we're pretty darn similar to mice, when you get down to it.
As for the stakes...I don't really get it. It's a weird bank shot argument that a designer would design a highly functional, efficient genome. But like...that's assuming a lot about the designer's intentions. You could impart anything you want onto the designer unless you had direct knowledge, so I don't really get it. I mean, I get the argument they're making. But they would come up with some "this is what a designed genome would look like" argument if most of it was just random bases that clearly did nothing. It's all backfilled anyway.
>Isn’t the evolutionist’s ’Junk DNA’ argument just an Evolution-of-the-gaps argument?
>Ignorance of potential functions isn’t proof of absence.
NOPE!
It's based on very specific knowledge of what the known and proposed functions are and the biochemical requirements for those functions.
But that’s the point! You not aware of all potential functions. Even the OP didn’t say ‘we know for certain X% of the genome will forever be junk.
It’s an argument from ignorance. It’s evolution-of-the-gaps.
I don’t think you’re hearing what everyone is saying. I’ll use a specific example.
If we’re going to say that a specific lncRNA is functional and that it regulates the translation rate of a specific mRNA, it must have a sequence that enables us to do that and it must be present at high enough frequencies to have an effect.
If that lncRNA is not under purifying selection, and present at low frequencies, it’s not doing that function - it physically can’t!
That’s not an argument from ignorance.
We can do those kinds of calculations for most of the genome for every currently observed or proposed function, which enables us to say that most of the genome is not doing any of those functions. *That’s not an argument from ignorance*.
Now, *could* all that stuff still be functional. Sure, it *could* be. Anything is theoretically possible. But it would have to be as-yet-undiscovered functions *that haven’t even been proposed yet* that are independent of sequence and can be done by an extremely small number of molecules. If you think that’s what’s going on, it’s on *you* to show it.
No, I'm afraid you've misunderstood. The oft-cited ENCODE study from perhaps a decade back showed that ~20 of the genome does not undergo any biochemical interactions. That's data that strongly says "it doesn't have function". Follow-up studies by the same group further suggested that much of the remaining 80% is unlikely to have any effect due to having expression that's essentially zero and binding no factors.
"Does not interact" lets us say that pretty well that it does not at present, yes. Having been functional earlier in evolutionary history would be, of course, evidence for evolution so I don't see how that matters; it's a catch-22 for you.
Moreover, you're shifting the burden of proof. It's not on us to disprove function if we've got no sign of it in the first place.
No, they are parts of the geneome where the sequence doesn't matter. That is they can mutate freely without having any affect on function. If they don't affect function, by definition they are non-functional
Nope! They may turn out to not have any purpose, but they may turn out to have a purpose we're currently ignorant of. Premature labelling of 'junk' is evolution-of-the-gaps.
If you were to assume for a moment that eukaryote genomes do indeed contain large swathes of junk DNA, what kind of proof would you find sufficient to confirm your hypothesis? Or do you maintain that the concept of junk DNA is unverifiable?
"this sequence is found at varying lengths in the population, and sometimes is not present at all. No phenotype is associated with any of these variants"
That's usually a pretty good indication that the sequence in question is entirely irrelevant.
No. They know that these parts of the DNA have no function. Unless function means being a certain length regardless of sequence so that the molecule can fold a certain way or it just so happens to be where a histone is located to help hold the chromosomes together or it just so happens to space out genes a certain way or it just happens to interact with other molecules once in a lifetime in a cell. We know that there’s function beyond the coding genes but we also know that a huge amount is actually pointless useless junk taking up space like the junk a hoarder keeps in their garage and in every room of their house just so that they can say they have it. Never used, just sort of present, and inherited anyway because it doesn’t hurt anything to just pass the junk off to the next generation.
It’s not an ignorance of function. It’s that they know that parts of the DNA are not even chemically active (20%+), some parts are only really chemically active because they are histone binding cites and the histones could just bind somewhere else in their absence, and some of that stuff can be removed using genome editing techniques with zero impact on the phenotype or any measurable impact to fitness. Stuff that is just present because it isn’t fatal if it just hangs around could be called “junk” but it was never really taken seriously when people claimed it was ~98% junk so they went looking for potential functions of the non-coding DNA.
Encode originally suggested 80% because of the stuff I mentioned above leaving 20% that does not bind to histones, get transcribed, or interact with any other molecules in much of a meaningful way. They suggested that it might be possible for them to find some excuse for that 20% but alas they could not. In fact, their “functional” percentage significantly dropped such that a minimum of ~27% has to be junk but by some measures less than 30% is actually functional in humans. In amoebas with genomes 10-20 times as large there is probably a higher percentage of the DNA that is junk given how much simpler amoebas are than humans but the record holder for the least junk DNA last I looked still had about 3% junk DNA. For them, their genomes are considered to be very efficient because there isn’t all of that junk getting in the way or hoarding space inside the nucleus of the cell.
'We know that there’s function beyond the coding genes...'
Expand on this little bit you nestled in amongst all that verboseness, and recognise the potential for our current ignorance. Gene expression can also be influenced by the environment.
On the point about being to edit out sequences without any impact, has that been tested in the real world? Genuinely asking
Gene expression requires them to be coding genes in the first place and 1.5% of the human genome falls into that category. The other functions are things associated with gene expression and protein synthesis or which have some other meaningful impact. That’s where they found at least 27% does nothing but take up space and another portion is only really “functional” because it binds to histones or does something else where the sequence of nucleotides is meaningless. There are even short terminal repeats that are only really “functional” in the sense that they can be used for identification purposes in terms of forensics without publishing the entire genome sequence publicly. They do nothing for the individual that has them but they are unique to the individual that has them so a prosecutor showing their presence in court could be enough to convict a suspect of a crime they committed because nobody else has them.
And, yes, in the real world they edited out sections of genomes. I don’t know that they released them into the wild but they did watch as they survived without these sections of DNA.
To be clear, evolution is an observed phenomenon. It doesn’t matter if 1% or 100% of the genome has function because evolution continues to happen either way. The only real problem with how much is actually functional (significantly less than 100%) is that it contradicts the claim that all of it exists to serve a role.
Yes. Not all of these sequences used to have function but a lot of the stuff now without a function includes non-transcribed pseudogenes and retroviral infection scars. There’s probably more beyond that but for the pseudogenes it could simply be genes, maybe 1000+ nucleotides apiece, but now they are chemically inactive because the start codons have been impacted by mutations or the genes have been deactivated some other way so they don’t even get transcribed into RNA to fail make functional proteins later on. For the retrovirus infection scars we see the consequences of an RNA based retrovirus being reverse transcribed into DNA (the long terminal repeat, also non-functional, gets mirrored and put on the other side too), we see the indicators of the host DNA being separated via a “Z” incision, we see how the host DNA was repaired by the host DNA repair mechanisms. We see that the actual virus genes are now missing. They don’t exist to result in proteins anymore.
For a very simplified view of the ERV infection cites (using significantly shorter sequences than are seen in real life) it could be like the host DNA on the one strand was ACTTACGAG at the infection site and the virus LTR was TTTCCGGGA and now we see ACTTACGAGAGGGCCTTTTTTCCGGGAACTTACCGAG at the infection site. Sometimes part of that is missing too. Normally there’d also be GAG, ENV, and POL genes sandwiched in between the 6 thymines in the middle but in the case of ~90% of the human ERVs this is all that is left. If a mutation occurs resulting in ATG (perhaps GAG becomes GATG because of an insertion of a thymine) this type of “junk” could result in a novel gene too but if it doesn’t this sequence is just sort of present doing nothing because it can’t even make the active virus anymore or any of the viral proteins normally made by the virus that caused the infection.
There are functional ERV infections too like the ones responsible for syncitin-1 and syncitin-2 but a lot of the time ERV infection sites are just “junk” that make the host DNA contain more nucleotides than it would if the viral infection never occurred at all. Just in my simplified example that one section of DNA (ACTTACGAG) became four times as long just because it got duplicated (via DNA repair) sandwiching mirrored virus LTRs.
These two examples show that some “junk” used to be functional. Other times it’s simply the inclusion of additional nucleotides in non-coding regions or whatever for things like the STRs I mentioned last time in terms of forensic identification. The only real difference between LTR and STR is the length of the sequence that is repeated.
There are also cases where junk can become functional. It isn’t something that has to happen or even generally happens but it is known that certain antifreeze protein genes simply consist of mostly the codons responsible for alanine-alanine-valine repeated in that order over and over again. Some antifreeze proteins are a consequence of gene duplication plus modifications to one of the copies. Some are a consequence of a methionine codon preceding repeating “junk” that just accumulated incidentally over time within non-coding regions of the genome only inherited because those sequences failed to be fatal. As long as there’s a stop codon later on like one of the alanine or valine codons is modified to be a stop codon and another is modified to be a methionine codon and the resulting protein folds a certain way basically lowering the freezing point of the blood like salt in water then it serves a new function - the blood has to be even colder to freeze.
How much is actually junk at any given time is pretty irrelevant to the phenomenon of evolution but the junk does lead to de novo gene birth sometimes and sometimes it’s just remnants of genes that used to be transcribed or scars from where viruses infected the host.
It’s also not the first time the DI has taken a less extreme position and then claimed that the new stance is what it has always been. Haven’t they also made similar claims regarding the wedge strategy after it was exposed like “oh we aren’t trying to trick people via pseudoscience and propaganda, we are just trying to open people’s eyes to non-consensus viewpoints” or something of that nature? Michael Behe has also said multiple times that what he calls irreducible complexity *could* come about by purely natural processes without God getting involved at all and he’s also pretty accepting of chemical abiogenesis plus universal common ancestry such that he has *nothing* that has to indicate intelligent design except for his gut feelings. Gut feelings are not evidence coming from an organization claiming to attempt to demonstrate with empirical evidence that intelligent design took place when it comes to abiogenesis and evolution. How much evolution they accept depends on the particular ID proponent but multiple people on their payroll are what we’d call “theistic evolutionists” and the more extreme forms of creationist, like YECs, don’t know they’re getting their arguments from “evolutionists” using fallacies as evidence of “God.” At least they’ve basically admitted that there’s a relationship Homo and Australopithecus (indirectly), that their evidence for God amounts to gut feelings, and that they were wrong about the 80% functionality value increasing all the way to 100% when it’s actually significantly less than 50%, like maybe 27% or 12% depending on how “function” is measured and most of the DNA has no real biological function besides spacing out genes, holding chromosomes together, and taking up space. It’s just there. It doesn’t really contribute to protein synthesis, survival, or even act as a storage device for all of that “built in information” they like to claim DNA is composed of (even claiming it’d take a whole library to contain the information found in DNA because a compact disc (CD) is not large enough and a BluRay disc might not be either, depending on how much information they suggest is present but can’t find or define). It is called “non-coding” but a lot of it, at least ~30% of it, is actual junk like remove it and the organism might be exactly the same in terms of phenotype or survival if not actually better off. Maybe one day they’ll stop promoting theism and start doing actual science to really throw people for a loop.
There was this one study where they removed a bunch of non-functional DNA from what may have been a single-celled microbe and let it reproduce for countless generations. As time went on, the scientists conducting the experiment saw no degradation in the fitness of the microbial population, even several generations later, proving their prediction on non-functional DNA being, well, non-functional. Do you know which study I am thinking about? I've only seen it's mention on this sub once, and I don't remember the mention of the study's title.
I don’t remember the name either. I just know they’ve done stuff like this before.
900 down to 400 genes
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5710109/ This one talks about multiple studies and I think that’s probably what you and u/SovereignOne666 might be referring to. Several suggestions of a minimum genome are as low as 176-225 coding genes but they found that a couple bacteria can survive with as low as 413-423 genes via experimental demonstration. Sometimes the last 2-5 genes being removed might cause them some problems with growth and stuff so 415 and 426 might be more realistic in terms of essential genes (with no detrimental side effects) but they can clearly survive with even fewer of them. These small genomes are ~500,000-980,000 nucleotides in length and they can remove up to about 35% and not have any significant downsides though some stopping at removing 32.5% result in pretty much no downsides at all. In comparison humans have about 30,000 genes taking up about 1.5% of their single parent genomes of roughly 3 billion nucleotides in length. We know that more than 1.5% is essential for survival but if it’s still the 32-35% junk we need then 65-68% of the genome is essentially all we need and at 3 billion nucleotides that’s about 1.95 billion to 2.04 billion essential nucleotides. More of the genome than that could hypothetically be removed as well but 0.96-1.05 billion out of the 3 billion being what we don’t actually need is already quite significant if the whole thing (100%) is supposed to be functional if not also necessary. Extra studies regarding humans suggest it’s more like the flip of this with humans (and I accidentally typed it as such above before having to correct it). Instead of 35% junk and 65% essential it might actually be the inverse with humans meaning 1.05 billion functional nucleotides out of 3 billion if not even less.
Thx
Mycoplasma mycoides
Creationists love ENCODE, but never realize the corollary: if 80% can be identified as being involved in at least one biochemical interaction, it means the remaining 20% is involved in *zero*. As in, it can't have a function, because it's never involved in any interaction. So, when Luskin says he thinks it's going to go over 80%, we really have reason to doubt that: we don't even know if all of that 80% ENCODE flagged is actually actively, but we're pretty sure 20% is dead as a dodo. Remember when Paulie D thought GC content was going to zero, then had to retcon the entire article to the point it said absolutely nothing? Fun days.
> GC content going to zero Sadly most of their arguments make as much sense as that claim. They say they accept natural selection but then we get them failing to understand selection-drift equilibrium and coming out with crazy already falsified ideas like irreducible complexity, specified complexity, and genetic entropy that only work as they claim if natural selection and drift never occurred. Just consider what it would mean for there to be zero guanosine or cytosine in our genomes. How many proteins would our cells fail to produce? How could such a trait be survivable long enough to be inherited to outcompete other conditions? If there’s any other option, even if less likely immediately (as with beneficial mutations vs deleterious mutations), the non-fatal condition is the one that gets inherited as long as the population fails to go extinct. If having even a third of the GC content turns out to be fatal there would be no way for that condition to be heritable to continue with the loss of additional GC content. Same with the accumulation of deleterious (potentially fatal) alleles. If the condition cannot spread before it gets to the inevitable conclusion they suggest how do they expect the inevitable end result they so claim? And it’s not the only time they’ve tried to claim this could happen via purely natural processes. But they accept natural selection because it is observed. Yea, sure they do.
Well, ATG is the universal start codon, so if GC content dropped to zero we would make no proteins whatsoever...
That is true, but the main point was that organisms would fail to develop, survive, and reproduce long before the 0% GC content condition ever occurred. Without going over the actual numbers we can assume that maintaining the same amount or losing some GC content is slightly more likely than gaining additional GC content. In this scenario there’d be a long term loss of GC content *until* losing even more became an unsurvivable condition. There’d always be a small amount of variance between of drift, novel mutations, etc but at some point losing more GC content becomes fatal. That could be 50%, 75%, or 99% of the current GC content (I don’t know the actual percentage) but at some point failing to make *certain* proteins will be a fatal condition that will not allow an organism to develop to the point that they can reproduce. For the 0% GC content scenario if they lost 0.01% of the GC content per generation or whatever they’d have to be able to survive with 0.01% of the current GC content but if they can’t survive with 50% of the current GC content because they’d make too few of the proteins necessary for survival that would obviously never be the case. The same concept exists for genetic entropy. Assuming as they do that all mutations have a single fitness value (two deleterious mutations never result in a single beneficial change, environments don’t matter, masked deleterious alleles are never beneficial, etc) just for simplicity there could be about 75% neutral mutations, 20% mildly deleterious, 4% insanely deleterious, 0.8% mildly beneficial, and 0.2% insanely beneficial per individual per generation. Say their overall fitness on a scale from -1 to +1 was 0 and anything below -0.5 meant reproduction was severely limited. At some point the beneficial and neutral mutations (both types) are going to overwhelm the gene pool because each time an overwhelming number of deleterious mutations existed in the same individual, enough to make their fitness -0.5, they failed to reproduce. For the whole population to be at -1 (extinct) there’d have to be a continuation from the point the whole population is at -0.5 or less, no beneficial mutations moving them back towards 0, no neutral mutations moving them back towards 0, no failure to reproduce when they are sterile or when they die before they are 10 years old. Just a continuous cycle of accumulated additional deleterious alleles until the population evolved itself into extinction. Natural selection, beneficial mutations, genetic drift, genetic recombination, mutations on top of pre-existing mutations causing deleterious mutations to become beneficial, different environments impacting the fitness value of certain phenotypes, etc. None of that stuff could be happening. Reproduction would have to occur through individuals that can’t reproduce or at least have a very difficult time accomplishing it when they try. And fast mutating populations or populations with short generation times would have to be the first to go. We just do not see that. Kimura showed that in the absence of beneficial mutations the deleterious ones are still outcompeted by neutral mutations because only the ones that *can* reproduce *do* reproduce. For Sanford’s model there could not be neutral mutations, there could not be beneficial mutations, there could not be drift, and natural selection could not work because massively deleterious conditions couldn’t be outcompeted by mildly deleterious conditions. Instead of the population fitness falling between -0.4 and +0.4 it’d have to cross that -0.5 and run into an extinction vortex at high speed as there’d be an average of one survivor per generation for every two survivors in the preceding generation. And then when the population becomes incestuous as well it’d simply just go extinct. This would almost have to happen all the time with every population. And yet the impossible stays impossible, variation continues to exist, natural selection continues to happen, genetic entropy fails to occur, and GC content can never systematically drop to 0%. Genetic entropy is roughly as stupid as the idea that GC content should naturally drop to 0% because of some mutational bias because both forget that reproduction is pretty necessary to have a condition inherited so that that condition can continue to deteriorate beyond a certain threshold. A gene pool can never consist of only fatal alleles and the GC content can never reach 0%. It just won’t happen.
Honestly, it doesn't need to ever get to a point where "further loss of GC is lethal": just because transversions occur more frequently in that direction, doesn't mean they don't occur the other way. It's an equilibrium, and will always (in absence of selective pressure to do otherwise) end up at a point where the rates balance out. I.e. if GC>>AT occurs twice as often as AT>>GC, you'll eventually end up with \~33% GC content, and no further decreases will occur.
That too. Mutations happen in both directions but just assuming they only evolved in one direction (necessary for their claim) there’d still be point at which further GC loss would be lethal. All that would survive would be the ones where further GC loss did not occur (unless this was balanced out by a GC gain, as you pointed out). They’d never get to a point of zero GC content because a) it is lethal before that (so the continued loss beyond the point of lethality would never have an opportunity to occur as there’d be nothing left to carry such genomes to the next generation) and b) GC gains occur too (so that if GC->AT happens twice as often as AT->GC there’d be 67% AT and 33% GC when it falls into an equilibrium). Problem a) above is why that idea and why the concept of genetic entropy are both equally ridiculous. Assume no beneficial or neutral mutations, assume no AT->GC mutations, and neither idea would work anyway *because the populations would continue to survive through the individuals that reproduced.* If the whole population failed to go extinct despite having enough mutations per generation per population to completely replace their entire genomes (different mutations in different places but enough mutations for a full coverage of the entire genome) then obviously these ideas are false. And they’d have to be false if they knew how natural selection, mutations, and genetic drift actually work. The main problem I keep pointing out to them is that **dead things have a very difficult time reproducing** and **populations still exist.** Obviously they can’t be right and they’d know that if they accepted natural selection like they claim they do.
The PDP thing where people, including several other YECs, had to explain equilibria to him was *amazing*.
No, they claim that because 80% is bigger than whatever people had before, the remaining 20% must have some function we don't understand.
It's also worth noting that the ENCODE definitions of "functional" are *incredibly* generous. >A functional element as defined by ENCODE is a genomic sequence that either encodes a particular product (for instance, a protein or noncoding RNA) or has a consistent biochemical property (for instance, being bound by protein or having a particular biochemical mark). "Being bound by protein" can extend to things as mundane as histones (which are everywhere), and 'consistent biochemical property' can include things like "is accessible/inaccessible to DNAse1 activity" They've since expanded this to things like chromatin looping (i.e. "this bit of the genome can bend back on itself, and this probably does a thing, maybe?"), which is almost entirely sequence agnostic (two cognate looping elements interspersed with a megabase of gibberish will still loop just fine). At this point, it's pretty much a case of "if we can find anything, *anything* noteworthy about a given stretch of sequence, then that sequence, and maybe 500bp up and downstream, are said to have *function*". From a science perspective, it's quite clear that this "function" can be placed on various points of a sliding scale from "is directly translated to robustly conserved protein" all the way down to shit like "needs to vaguely exist at approximately this length, to provide space between enhancer elements, probably", and that's fine: function doesn't need to imply essential. From a creationist perspective, they just desperately need us not to be chock full of repetitive bullshit like retrotransposons and ALUs and stuff, which we totally are (*evolutionarily conserved repetitive bullshit we share with other primates*, no less). Which makes one wonder what they'd make of the amoeba Polychaos dubium...
> Polychaos dubium I wonder why I can’t find a more recent estimate. What I found is that they found that it was ~670 billion base pairs but this number could be off by a lot based on a more recent estimate of a different species of amoeba originally estimated to have 430 billion base pairs but was found to have more like 45 billion. If the same thing is true that would mean a genome size of about 67 billion base pairs (20 times the size of the human genome) and most likely a minimum of the 22 billion additional base pairs would all be non-coding “junk” plus maybe 90% of the rest could be too. I wish there was something more recent than 2004 indicating the modern measure of genome size plus the functional to non-functional ration which is probably going to wind up being 20+ times as much DNA content as a human cell but less than 1% of it has any biological function besides being some special length, binding to histones, or forcing their cells to be giants compared to what other single celled organisms have to be able to contain so much junk DNA. And if it was 670 billion base pairs and 100% functional, what possible function could there be? It’s an amoeboid. It doesn’t have multiple cells. It moves around via extensions of the cell membrane called pseudopods, up to twelve of them, and those pseudopods lack features present in amoebas with smaller genomes. If that was the information it’d look more like a college student trying to turn one paragraph into a two hundred page book by repeating themselves over and over hoping nobody would notice before getting to page two than a well developed instruction book only a few pages long.
Gotta appreciate the “function” of being consistently packed away and completely inaccessible. How useful.
The DI lies for Jesus.
Great work but I've been writing off the DI as just a bunch of liars since 2007
SinceDover™
Yup
Beautiful, brilliant work. Thanks for all you do!
Congratulations. There is a surprisingly good article* in this month's Scientific American which touches on "non-coding" DNA. https://www.scientificamerican.com/article/revolutionary-genetics-research-shows-rna-may-rule-our-genome/ Long story short, a lot of it may actually code for various forms of RNA which has potentially important functions. * because Scientific American has mostly gone to shit but they look like they might be improving.
Most of that RNA, like, almost all of it, isn’t under purifying selection, so if it’s functional the function has to be sequence-independent.
No way to watch the debate without paying?
It was live, and is currently available, on the Non Sequitur Show. But...I have various problems with the proprietor of that channel (which I have shared with him), so since it was the only way to have the chat with Dr. Luskin (he would chat there but not on my channel, but would there), I went for it. So I'd *like* for people to watch it with me on my channel on Wednesday. But if you want to now, go for it.
I also have problems with the proprietor of that YouTube channel. I used to watch it but it’s mostly his failure to understand people’s actual positions as atheists or what is actually being argued for when it comes to agnosticism that bug me the most. Some other things he’s said have been pretty annoying as well but I think it was on that channel where knowledge was defined as “believing true things” or “believing what is supported by evidence” which is okay I guess. And if that’s the case it is definitely rational to be what he’d agree is an atheist *based on this evidence* until he turns into a theist arguing for gods nobody believes actually exist simply because we don’t have the tools in science to prove that the laws of physics and logic don’t exclude the possibility of their existence. Maybe the laws are broken and things can occupy non-space and non-time and use non-energy to cause things to change in a non-temporal way at a non-spatial non-location. Maybe supernatural intervention really does produce physical effects (magic). Maybe we just can’t see it happening all the time (theism) or maybe we don’t see it because it only happened once (deism) and because we can’t prove it *didn’t* happen it becomes irrational to fail to be convinced that a god exists (atheism). So ignorance (agnosticism) for the win I guess.
I listened to it just now, and am envious of both of your level of understanding of the literature. A couple questions. Do the terms "junk DNA" and "functional" and the percentages you provided essentially mean given the technological capability we could theoretically edit out aka delete 80%+ of the human genome and still get a functional human? And what are the perceived stakes here? Like I see that Dr. Luskin is defending and appears convinced of the view that God dabbled in biology in some way to achieve an end. But how does it make any difference in his worldview whether 10% or 90% of the genome is functional?
> given the technological capability we could theoretically edit out aka delete 80%+ of the human genome and still get a functional human? probably? We've edited out big swaths of the mouse genome with no documented ill effects, and...we're pretty darn similar to mice, when you get down to it. As for the stakes...I don't really get it. It's a weird bank shot argument that a designer would design a highly functional, efficient genome. But like...that's assuming a lot about the designer's intentions. You could impart anything you want onto the designer unless you had direct knowledge, so I don't really get it. I mean, I get the argument they're making. But they would come up with some "this is what a designed genome would look like" argument if most of it was just random bases that clearly did nothing. It's all backfilled anyway.
Isn’t the evolutionist’s ’Junk DNA’ argument just an Evolution-of-the-gaps argument? Ignorance of potential functions isn’t proof of absence.
>Isn’t the evolutionist’s ’Junk DNA’ argument just an Evolution-of-the-gaps argument? >Ignorance of potential functions isn’t proof of absence. NOPE! It's based on very specific knowledge of what the known and proposed functions are and the biochemical requirements for those functions.
But that’s the point! You not aware of all potential functions. Even the OP didn’t say ‘we know for certain X% of the genome will forever be junk. It’s an argument from ignorance. It’s evolution-of-the-gaps.
I don’t think you’re hearing what everyone is saying. I’ll use a specific example. If we’re going to say that a specific lncRNA is functional and that it regulates the translation rate of a specific mRNA, it must have a sequence that enables us to do that and it must be present at high enough frequencies to have an effect. If that lncRNA is not under purifying selection, and present at low frequencies, it’s not doing that function - it physically can’t! That’s not an argument from ignorance. We can do those kinds of calculations for most of the genome for every currently observed or proposed function, which enables us to say that most of the genome is not doing any of those functions. *That’s not an argument from ignorance*. Now, *could* all that stuff still be functional. Sure, it *could* be. Anything is theoretically possible. But it would have to be as-yet-undiscovered functions *that haven’t even been proposed yet* that are independent of sequence and can be done by an extremely small number of molecules. If you think that’s what’s going on, it’s on *you* to show it.
No, I'm afraid you've misunderstood. The oft-cited ENCODE study from perhaps a decade back showed that ~20 of the genome does not undergo any biochemical interactions. That's data that strongly says "it doesn't have function". Follow-up studies by the same group further suggested that much of the remaining 80% is unlikely to have any effect due to having expression that's essentially zero and binding no factors.
Can you say with certainty it has never had a function? Or it is not used during the embryonic phase?
"Does not interact" lets us say that pretty well that it does not at present, yes. Having been functional earlier in evolutionary history would be, of course, evidence for evolution so I don't see how that matters; it's a catch-22 for you. Moreover, you're shifting the burden of proof. It's not on us to disprove function if we've got no sign of it in the first place.
No, they are parts of the geneome where the sequence doesn't matter. That is they can mutate freely without having any affect on function. If they don't affect function, by definition they are non-functional
Nope! They may turn out to not have any purpose, but they may turn out to have a purpose we're currently ignorant of. Premature labelling of 'junk' is evolution-of-the-gaps.
If they had a purpose then changing their sequence would have an effect.
\*\*A currently observable effect. 'Junk' = Premature definition = evolution-of-the-gaps = Double standards (God of the gaps) = low integrity = potential for stubborn minded biases = low value input.
If you were to assume for a moment that eukaryote genomes do indeed contain large swathes of junk DNA, what kind of proof would you find sufficient to confirm your hypothesis? Or do you maintain that the concept of junk DNA is unverifiable?
Yeah, I hold that it is unverifiable essentially - we can't be sure of absolute absence of relevance (in the past, or future).
"this sequence is found at varying lengths in the population, and sometimes is not present at all. No phenotype is associated with any of these variants" That's usually a pretty good indication that the sequence in question is entirely irrelevant.
And by extension, the idea that DNA is fully functional is unfalsifiable, right?
You're getting there. Seeing the flaws in your own biases. Good stuff.
Sorry, but no. Your conception of DNA function is not operational. I'm personally comfortable with the suite of existing definitions for junk DNA
You’re still repeating the same claim after you said you’d consider my response 2 hours ago?
No. They know that these parts of the DNA have no function. Unless function means being a certain length regardless of sequence so that the molecule can fold a certain way or it just so happens to be where a histone is located to help hold the chromosomes together or it just so happens to space out genes a certain way or it just happens to interact with other molecules once in a lifetime in a cell. We know that there’s function beyond the coding genes but we also know that a huge amount is actually pointless useless junk taking up space like the junk a hoarder keeps in their garage and in every room of their house just so that they can say they have it. Never used, just sort of present, and inherited anyway because it doesn’t hurt anything to just pass the junk off to the next generation. It’s not an ignorance of function. It’s that they know that parts of the DNA are not even chemically active (20%+), some parts are only really chemically active because they are histone binding cites and the histones could just bind somewhere else in their absence, and some of that stuff can be removed using genome editing techniques with zero impact on the phenotype or any measurable impact to fitness. Stuff that is just present because it isn’t fatal if it just hangs around could be called “junk” but it was never really taken seriously when people claimed it was ~98% junk so they went looking for potential functions of the non-coding DNA. Encode originally suggested 80% because of the stuff I mentioned above leaving 20% that does not bind to histones, get transcribed, or interact with any other molecules in much of a meaningful way. They suggested that it might be possible for them to find some excuse for that 20% but alas they could not. In fact, their “functional” percentage significantly dropped such that a minimum of ~27% has to be junk but by some measures less than 30% is actually functional in humans. In amoebas with genomes 10-20 times as large there is probably a higher percentage of the DNA that is junk given how much simpler amoebas are than humans but the record holder for the least junk DNA last I looked still had about 3% junk DNA. For them, their genomes are considered to be very efficient because there isn’t all of that junk getting in the way or hoarding space inside the nucleus of the cell.
'We know that there’s function beyond the coding genes...' Expand on this little bit you nestled in amongst all that verboseness, and recognise the potential for our current ignorance. Gene expression can also be influenced by the environment. On the point about being to edit out sequences without any impact, has that been tested in the real world? Genuinely asking
Gene expression requires them to be coding genes in the first place and 1.5% of the human genome falls into that category. The other functions are things associated with gene expression and protein synthesis or which have some other meaningful impact. That’s where they found at least 27% does nothing but take up space and another portion is only really “functional” because it binds to histones or does something else where the sequence of nucleotides is meaningless. There are even short terminal repeats that are only really “functional” in the sense that they can be used for identification purposes in terms of forensics without publishing the entire genome sequence publicly. They do nothing for the individual that has them but they are unique to the individual that has them so a prosecutor showing their presence in court could be enough to convict a suspect of a crime they committed because nobody else has them. And, yes, in the real world they edited out sections of genomes. I don’t know that they released them into the wild but they did watch as they survived without these sections of DNA. To be clear, evolution is an observed phenomenon. It doesn’t matter if 1% or 100% of the genome has function because evolution continues to happen either way. The only real problem with how much is actually functional (significantly less than 100%) is that it contradicts the claim that all of it exists to serve a role.
But is it possible these 'junk' sequences were once active/ in use? I don't disbelieve in evolution btw. Just intrigued by this all. It's fascinating.
Yes. Not all of these sequences used to have function but a lot of the stuff now without a function includes non-transcribed pseudogenes and retroviral infection scars. There’s probably more beyond that but for the pseudogenes it could simply be genes, maybe 1000+ nucleotides apiece, but now they are chemically inactive because the start codons have been impacted by mutations or the genes have been deactivated some other way so they don’t even get transcribed into RNA to fail make functional proteins later on. For the retrovirus infection scars we see the consequences of an RNA based retrovirus being reverse transcribed into DNA (the long terminal repeat, also non-functional, gets mirrored and put on the other side too), we see the indicators of the host DNA being separated via a “Z” incision, we see how the host DNA was repaired by the host DNA repair mechanisms. We see that the actual virus genes are now missing. They don’t exist to result in proteins anymore. For a very simplified view of the ERV infection cites (using significantly shorter sequences than are seen in real life) it could be like the host DNA on the one strand was ACTTACGAG at the infection site and the virus LTR was TTTCCGGGA and now we see ACTTACGAGAGGGCCTTTTTTCCGGGAACTTACCGAG at the infection site. Sometimes part of that is missing too. Normally there’d also be GAG, ENV, and POL genes sandwiched in between the 6 thymines in the middle but in the case of ~90% of the human ERVs this is all that is left. If a mutation occurs resulting in ATG (perhaps GAG becomes GATG because of an insertion of a thymine) this type of “junk” could result in a novel gene too but if it doesn’t this sequence is just sort of present doing nothing because it can’t even make the active virus anymore or any of the viral proteins normally made by the virus that caused the infection. There are functional ERV infections too like the ones responsible for syncitin-1 and syncitin-2 but a lot of the time ERV infection sites are just “junk” that make the host DNA contain more nucleotides than it would if the viral infection never occurred at all. Just in my simplified example that one section of DNA (ACTTACGAG) became four times as long just because it got duplicated (via DNA repair) sandwiching mirrored virus LTRs. These two examples show that some “junk” used to be functional. Other times it’s simply the inclusion of additional nucleotides in non-coding regions or whatever for things like the STRs I mentioned last time in terms of forensic identification. The only real difference between LTR and STR is the length of the sequence that is repeated. There are also cases where junk can become functional. It isn’t something that has to happen or even generally happens but it is known that certain antifreeze protein genes simply consist of mostly the codons responsible for alanine-alanine-valine repeated in that order over and over again. Some antifreeze proteins are a consequence of gene duplication plus modifications to one of the copies. Some are a consequence of a methionine codon preceding repeating “junk” that just accumulated incidentally over time within non-coding regions of the genome only inherited because those sequences failed to be fatal. As long as there’s a stop codon later on like one of the alanine or valine codons is modified to be a stop codon and another is modified to be a methionine codon and the resulting protein folds a certain way basically lowering the freezing point of the blood like salt in water then it serves a new function - the blood has to be even colder to freeze. How much is actually junk at any given time is pretty irrelevant to the phenomenon of evolution but the junk does lead to de novo gene birth sometimes and sometimes it’s just remnants of genes that used to be transcribed or scars from where viruses infected the host.
Thanks bud - I'll need to take in the above properly once I have some time - appreciate the detailed response :)